Review



arp2 3 inhibitor tocris bioscience  (Tocris)


Bioz Verified Symbol Tocris is a verified supplier
Bioz Manufacturer Symbol Tocris manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Tocris arp2 3 inhibitor tocris bioscience
    Arp2 3 Inhibitor Tocris Bioscience, supplied by Tocris, used in various techniques. Bioz Stars score: 94/100, based on 106 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ck+666+tocris/CK+666/pmc07900713__mmc6-318-234-236
    Average 94 stars, based on 106 article reviews
    arp2 3 inhibitor tocris bioscience - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Virus:

    Article Title: Activity-Dependent Actin Remodeling at the Base of Dendritic Spines Promotes Microtubule Entry.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies mouse anti-myc (clone 9E10) Santa Cruz sc-40 mouse anti-myc (Ab-1) Oncogene Research AB-1 Alexa 647 Goat Anti-Mouse IgG (H+L) Molecular Probes, Life Technologies Cat#A21236, RRID: AB_141725 rabbit anti-RFP Rockland 600-401-379 anti-rabbit-D2 Ultivue N/A rabbit anti-Cortactin Santa Cruz H-191:sc-11408 rabbit anti-Drebrin Abcam ab11068 Bacterial and Virus Strains Escherichia coli: DH10B N/A N/A Escherichia coli: Stbl3 ThermoFisher Cat# C737303 Escherichia coli: BL21DE3 N/A N/A pLVTHPS-mEBFP2-HA_shRNA This paper N/A pSIN-TRE-MCS-Synapsin-rtTA2 [36] N/A pSIN-TRE-mTagRFP_IRES_GFP-MACF18-Synapsin-rtTA2 [36] N/A pSIN-TRE-mTagRFP_IRES_GFP-EB3-rescue-Synapsin-rtTA2 This paper N/A pSIN-TRE-mTagRFP_IRES_GFP-EB3-DAc-Synapsin-rtTA2 This paper N/A pSIN-TRE-Lifeact-TagRFP-Myc_IRES_GFP-MACF18-Synapsin-rtTA2 This paper N/A pSIN-TRE-Lifeact-GCaMP6s_IRES_Tomato-MACF18-Synapsin-rtTA2 This paper N/A pSIN-TRE-TagRFP-ER_IRES_GFP-MACF18-Synapsin-rtTA2 This paper N/A pSIN-TRE-Cortactin-dsRed_IRES_GFP-MACF18-Synapsin-rtTA2 This paper N/A pSIN-TRE-mEBFP2-HA_P2A_Myc-MyoVa-tail-Synapsin-rtTA2 This paper N/A Chemicals, Peptides, and Recombinant Proteins Lipofectamine 2000 ThermoFisher Cat# 11668019 APV Tocris Cat# 0106 CK-666 Tocris Cat# 3950 DHPG Tocris Cat# 0805 Jasplakinolide Tocris Cat# 2792 Latrunculin B Santa Cruz Cat# SC-203318 Methacholine Sigma Cat# A2251 MNI-Glutamate Tocris Cat# 1490 NMDA Sigma Cat# M3262 Picrotoxin (PTX) Tocris Cat# 1128 PP2 Tocris Cat# 1407 Trolox Sigma Cat# 238813 Tetrodotoxin (TTX) Abcam Cat# ab120055 Experimental Models: Organisms/Strains Hippocampal neuron cultures from embryonic day 18 rat brains (Wistar) N/A N/A Hippocampal organotypic slice cultures from P5-6 mice (C57BL/6) N/A N/A Recombinant DNA p.MDG2 Dr. Didier Trono (EPFL) addgene #12259 psPAX2 Dr. Didier Trono (EPFL) addgene #12260 GW2_Lifeact-GFP This paper N/A bactin_Cortactin-dsRed-exp [37], subcloned and mutated for this paper N/A (Continued on next page) e1 Current Biology 28, 1–13.e1–e6, July 9, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER pET28a_Lifeact-GFP [33] N/A pET28a_Lifeact-mNeonGreen This paper N/A shRNA targeting sequence: scrambled: GGTTTATATCGCGGTTATT This paper N/A shRNA targeting sequence: Cortactin: GCACTGCTCACAAGTGGAC [24] N/A shRNA targeting sequence: Drebrin: GAGAACCAGAAAGTGATGTAC [27] N/A shRNA targeting sequence: EB3: ACTATGATGGAAAGGATTAC [38] N/A shRNA targeting sequence: MACF2: GCCGTGGTCAGAGTTGCTGAT This paper N/A shRNA targeting sequence: MARCKS: CTGTACCAGTCAGTAATTA [25] N/A shRNA targeting sequence: MyosinIIb: GATCAAAGTTGGCCGAGAT [26] N/A Software and Algorithms FIJI http://fiji.sc/ N/A DoM Utrecht [39] https://github.com/ekatrukha/ DoM_Utrecht KymoResliceWide GitHub https://github.com/ekatrukha/ KymoResliceWide Prism GraphPad N/A MATLAB MathWorks N/A

    Recombinant:

    Article Title: Activity-Dependent Actin Remodeling at the Base of Dendritic Spines Promotes Microtubule Entry.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies mouse anti-myc (clone 9E10) Santa Cruz sc-40 mouse anti-myc (Ab-1) Oncogene Research AB-1 Alexa 647 Goat Anti-Mouse IgG (H+L) Molecular Probes, Life Technologies Cat#A21236, RRID: AB_141725 rabbit anti-RFP Rockland 600-401-379 anti-rabbit-D2 Ultivue N/A rabbit anti-Cortactin Santa Cruz H-191:sc-11408 rabbit anti-Drebrin Abcam ab11068 Bacterial and Virus Strains Escherichia coli: DH10B N/A N/A Escherichia coli: Stbl3 ThermoFisher Cat# C737303 Escherichia coli: BL21DE3 N/A N/A pLVTHPS-mEBFP2-HA_shRNA This paper N/A pSIN-TRE-MCS-Synapsin-rtTA2 [36] N/A pSIN-TRE-mTagRFP_IRES_GFP-MACF18-Synapsin-rtTA2 [36] N/A pSIN-TRE-mTagRFP_IRES_GFP-EB3-rescue-Synapsin-rtTA2 This paper N/A pSIN-TRE-mTagRFP_IRES_GFP-EB3-DAc-Synapsin-rtTA2 This paper N/A pSIN-TRE-Lifeact-TagRFP-Myc_IRES_GFP-MACF18-Synapsin-rtTA2 This paper N/A pSIN-TRE-Lifeact-GCaMP6s_IRES_Tomato-MACF18-Synapsin-rtTA2 This paper N/A pSIN-TRE-TagRFP-ER_IRES_GFP-MACF18-Synapsin-rtTA2 This paper N/A pSIN-TRE-Cortactin-dsRed_IRES_GFP-MACF18-Synapsin-rtTA2 This paper N/A pSIN-TRE-mEBFP2-HA_P2A_Myc-MyoVa-tail-Synapsin-rtTA2 This paper N/A Chemicals, Peptides, and Recombinant Proteins Lipofectamine 2000 ThermoFisher Cat# 11668019 APV Tocris Cat# 0106 CK-666 Tocris Cat# 3950 DHPG Tocris Cat# 0805 Jasplakinolide Tocris Cat# 2792 Latrunculin B Santa Cruz Cat# SC-203318 Methacholine Sigma Cat# A2251 MNI-Glutamate Tocris Cat# 1490 NMDA Sigma Cat# M3262 Picrotoxin (PTX) Tocris Cat# 1128 PP2 Tocris Cat# 1407 Trolox Sigma Cat# 238813 Tetrodotoxin (TTX) Abcam Cat# ab120055 Experimental Models: Organisms/Strains Hippocampal neuron cultures from embryonic day 18 rat brains (Wistar) N/A N/A Hippocampal organotypic slice cultures from P5-6 mice (C57BL/6) N/A N/A Recombinant DNA p.MDG2 Dr. Didier Trono (EPFL) addgene #12259 psPAX2 Dr. Didier Trono (EPFL) addgene #12260 GW2_Lifeact-GFP This paper N/A bactin_Cortactin-dsRed-exp [37], subcloned and mutated for this paper N/A (Continued on next page) e1 Current Biology 28, 1–13.e1–e6, July 9, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER pET28a_Lifeact-GFP [33] N/A pET28a_Lifeact-mNeonGreen This paper N/A shRNA targeting sequence: scrambled: GGTTTATATCGCGGTTATT This paper N/A shRNA targeting sequence: Cortactin: GCACTGCTCACAAGTGGAC [24] N/A shRNA targeting sequence: Drebrin: GAGAACCAGAAAGTGATGTAC [27] N/A shRNA targeting sequence: EB3: ACTATGATGGAAAGGATTAC [38] N/A shRNA targeting sequence: MACF2: GCCGTGGTCAGAGTTGCTGAT This paper N/A shRNA targeting sequence: MARCKS: CTGTACCAGTCAGTAATTA [25] N/A shRNA targeting sequence: MyosinIIb: GATCAAAGTTGGCCGAGAT [26] N/A Software and Algorithms FIJI http://fiji.sc/ N/A DoM Utrecht [39] https://github.com/ekatrukha/ DoM_Utrecht KymoResliceWide GitHub https://github.com/ekatrukha/ KymoResliceWide Prism GraphPad N/A MATLAB MathWorks N/A



    Similar Products

    arp2 3 inhibitor tocris bioscience  (Tocris)
    94
    Tocris arp2 3 inhibitor tocris bioscience
    Arp2 3 Inhibitor Tocris Bioscience, supplied by Tocris, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ck+666+tocris/CK+666/pmc07900713__mmc6-318-234-236
    Average 94 stars, based on 1 article reviews
    arp2 3 inhibitor tocris bioscience - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    ck666 tocris  (Tocris)
    95
    Tocris ck666 tocris
    A) Time-lapse stills of C. rubida embryos that were treated with either 0.1% DMSO or 100 μM <t>CK666</t> to inhibit Arp2/3 after completing second meiosis. While the initial vegetal elongation in the zygote was observed in treated embryos (k-m), further constriction of the polar lobe neck did not occur, resulting in a shift in the position of the spindle and cleavage plane (p) and an exaggerated asymmetric cell division compared to controls. Bar, 30 μm. B) Phenotypic analysis of embryos treated with either 0.1% DMSO or 100 μM CK666, and after first division fixed and stained with Hoechst 33342 to detect DNA. Wild-type (blue bar) embryos were characterized by a larger CD blastomere and a smaller AB blastomere. The frequency of embryos with symmetric blastomeres (red bar) was not affected by CK666 treatment, whereas there was a significant increase in embryos with highly asymmetrical blastomeres (magenta bar). A small but insignificant increase in 3 cell embryos (green bar) was also observed. Errors bar represent SD for three replicate experiments per condition, >50 embryos per experiment, **p<0.01 as determined by two-way ANOVA analysis.
    Ck666 Tocris, supplied by Tocris, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ck+666+tocris/CK+666/pmc06925573-482-49-50
    Average 95 stars, based on 1 article reviews
    ck666 tocris - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    tocris 3950  (Tocris)
    94
    Tocris tocris 3950
    A) Time-lapse stills of C. rubida embryos that were treated with either 0.1% DMSO or 100 μM <t>CK666</t> to inhibit Arp2/3 after completing second meiosis. While the initial vegetal elongation in the zygote was observed in treated embryos (k-m), further constriction of the polar lobe neck did not occur, resulting in a shift in the position of the spindle and cleavage plane (p) and an exaggerated asymmetric cell division compared to controls. Bar, 30 μm. B) Phenotypic analysis of embryos treated with either 0.1% DMSO or 100 μM CK666, and after first division fixed and stained with Hoechst 33342 to detect DNA. Wild-type (blue bar) embryos were characterized by a larger CD blastomere and a smaller AB blastomere. The frequency of embryos with symmetric blastomeres (red bar) was not affected by CK666 treatment, whereas there was a significant increase in embryos with highly asymmetrical blastomeres (magenta bar). A small but insignificant increase in 3 cell embryos (green bar) was also observed. Errors bar represent SD for three replicate experiments per condition, >50 embryos per experiment, **p<0.01 as determined by two-way ANOVA analysis.
    Tocris 3950, supplied by Tocris, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ck+666+tocris/CK+666/pm33282870-177-14-14
    Average 94 stars, based on 1 article reviews
    tocris 3950 - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    sc 3550a ck666 tocris  (Tocris)
    95
    Tocris sc 3550a ck666 tocris
    A) Time-lapse stills of C. rubida embryos that were treated with either 0.1% DMSO or 100 μM <t>CK666</t> to inhibit Arp2/3 after completing second meiosis. While the initial vegetal elongation in the zygote was observed in treated embryos (k-m), further constriction of the polar lobe neck did not occur, resulting in a shift in the position of the spindle and cleavage plane (p) and an exaggerated asymmetric cell division compared to controls. Bar, 30 μm. B) Phenotypic analysis of embryos treated with either 0.1% DMSO or 100 μM CK666, and after first division fixed and stained with Hoechst 33342 to detect DNA. Wild-type (blue bar) embryos were characterized by a larger CD blastomere and a smaller AB blastomere. The frequency of embryos with symmetric blastomeres (red bar) was not affected by CK666 treatment, whereas there was a significant increase in embryos with highly asymmetrical blastomeres (magenta bar). A small but insignificant increase in 3 cell embryos (green bar) was also observed. Errors bar represent SD for three replicate experiments per condition, >50 embryos per experiment, **p<0.01 as determined by two-way ANOVA analysis.
    Sc 3550a Ck666 Tocris, supplied by Tocris, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ck+666+tocris/CK+666/pm30982662-396-112-114
    Average 95 stars, based on 1 article reviews
    sc 3550a ck666 tocris - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    ck 666 tocris  (Tocris)
    94
    Tocris ck 666 tocris
    A) Time-lapse stills of C. rubida embryos that were treated with either 0.1% DMSO or 100 μM <t>CK666</t> to inhibit Arp2/3 after completing second meiosis. While the initial vegetal elongation in the zygote was observed in treated embryos (k-m), further constriction of the polar lobe neck did not occur, resulting in a shift in the position of the spindle and cleavage plane (p) and an exaggerated asymmetric cell division compared to controls. Bar, 30 μm. B) Phenotypic analysis of embryos treated with either 0.1% DMSO or 100 μM CK666, and after first division fixed and stained with Hoechst 33342 to detect DNA. Wild-type (blue bar) embryos were characterized by a larger CD blastomere and a smaller AB blastomere. The frequency of embryos with symmetric blastomeres (red bar) was not affected by CK666 treatment, whereas there was a significant increase in embryos with highly asymmetrical blastomeres (magenta bar). A small but insignificant increase in 3 cell embryos (green bar) was also observed. Errors bar represent SD for three replicate experiments per condition, >50 embryos per experiment, **p<0.01 as determined by two-way ANOVA analysis.
    Ck 666 Tocris, supplied by Tocris, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ck+666+tocris/CK+666/pm29910073-280-120-121
    Average 94 stars, based on 1 article reviews
    ck 666 tocris - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    ck 666 tocris  (Santa Cruz Biotechnology)
    90
    Santa Cruz Biotechnology ck 666 tocris
    A) Time-lapse stills of C. rubida embryos that were treated with either 0.1% DMSO or 100 μM <t>CK666</t> to inhibit Arp2/3 after completing second meiosis. While the initial vegetal elongation in the zygote was observed in treated embryos (k-m), further constriction of the polar lobe neck did not occur, resulting in a shift in the position of the spindle and cleavage plane (p) and an exaggerated asymmetric cell division compared to controls. Bar, 30 μm. B) Phenotypic analysis of embryos treated with either 0.1% DMSO or 100 μM CK666, and after first division fixed and stained with Hoechst 33342 to detect DNA. Wild-type (blue bar) embryos were characterized by a larger CD blastomere and a smaller AB blastomere. The frequency of embryos with symmetric blastomeres (red bar) was not affected by CK666 treatment, whereas there was a significant increase in embryos with highly asymmetrical blastomeres (magenta bar). A small but insignificant increase in 3 cell embryos (green bar) was also observed. Errors bar represent SD for three replicate experiments per condition, >50 embryos per experiment, **p<0.01 as determined by two-way ANOVA analysis.
    Ck 666 Tocris, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ck+666+tocris/CK+666/pm29910073-280-120-134
    Average 90 stars, based on 1 article reviews
    ck 666 tocris - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    A) Time-lapse stills of C. rubida embryos that were treated with either 0.1% DMSO or 100 μM CK666 to inhibit Arp2/3 after completing second meiosis. While the initial vegetal elongation in the zygote was observed in treated embryos (k-m), further constriction of the polar lobe neck did not occur, resulting in a shift in the position of the spindle and cleavage plane (p) and an exaggerated asymmetric cell division compared to controls. Bar, 30 μm. B) Phenotypic analysis of embryos treated with either 0.1% DMSO or 100 μM CK666, and after first division fixed and stained with Hoechst 33342 to detect DNA. Wild-type (blue bar) embryos were characterized by a larger CD blastomere and a smaller AB blastomere. The frequency of embryos with symmetric blastomeres (red bar) was not affected by CK666 treatment, whereas there was a significant increase in embryos with highly asymmetrical blastomeres (magenta bar). A small but insignificant increase in 3 cell embryos (green bar) was also observed. Errors bar represent SD for three replicate experiments per condition, >50 embryos per experiment, **p<0.01 as determined by two-way ANOVA analysis.

    Journal: Developmental biology

    Article Title: Cytoskeletal polarization and cytokinetic signaling drives polar lobe formation in spiralian embryos

    doi: 10.1016/j.ydbio.2019.08.020

    Figure Lengend Snippet: A) Time-lapse stills of C. rubida embryos that were treated with either 0.1% DMSO or 100 μM CK666 to inhibit Arp2/3 after completing second meiosis. While the initial vegetal elongation in the zygote was observed in treated embryos (k-m), further constriction of the polar lobe neck did not occur, resulting in a shift in the position of the spindle and cleavage plane (p) and an exaggerated asymmetric cell division compared to controls. Bar, 30 μm. B) Phenotypic analysis of embryos treated with either 0.1% DMSO or 100 μM CK666, and after first division fixed and stained with Hoechst 33342 to detect DNA. Wild-type (blue bar) embryos were characterized by a larger CD blastomere and a smaller AB blastomere. The frequency of embryos with symmetric blastomeres (red bar) was not affected by CK666 treatment, whereas there was a significant increase in embryos with highly asymmetrical blastomeres (magenta bar). A small but insignificant increase in 3 cell embryos (green bar) was also observed. Errors bar represent SD for three replicate experiments per condition, >50 embryos per experiment, **p<0.01 as determined by two-way ANOVA analysis.

    Article Snippet: ​ Reagent or resource Source Identifier Antibodies Mouse monoclonal anti-Arp3 Sigma-Aldrich Cat#A5979 Rabbit anti-phospho Ser19 myosin regulatory light chain Cell signaling Cat#3671S Rat anti-αTubulin (YL1/2) Santa Cruz Biotechnology Cat#sc-53029 Rabbit anti-phosphohistone H3 Ser10 Sigma-Aldrich Cat#9701S Bacterial and Virus Strains Biological Samples Chemicals, Peptides, and Recombinant Proteins Serotonin Sigma-Aldrich Cat#H7752 CK666 Tocris Cat#3950 ZM447439 Tocris Cat#2458 Nocodazole Selleckchem Cat#S2775 Critical Commercial Assays Deposited Data Experimental Models: Cell Lines Experimental Models: Organisms/Strains Chlamys rubida San Juan Island, WA N/A Chlamys hastata San Juan Island, WA N/A Crassostrea gigas San Juan Island, WA N/A Oligonucleotides Recombinant DNA Software and Algorithms GraphPad Prism 6 Two-way ANOVA with Tukey-Kramer’s post-hoc test; GraphPad Prism v6.00 for Apple, GraphPad Software, San Diego California USA. www.graphpad.com Other Open in a separate window KEY RESOURCES TABLE Polar lobe initiation in mollusks is independent of cytokinetic signaling.

    Techniques: Staining

    KEY RESOURCES TABLE

    Journal: Developmental biology

    Article Title: Cytoskeletal polarization and cytokinetic signaling drives polar lobe formation in spiralian embryos

    doi: 10.1016/j.ydbio.2019.08.020

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: ​ Reagent or resource Source Identifier Antibodies Mouse monoclonal anti-Arp3 Sigma-Aldrich Cat#A5979 Rabbit anti-phospho Ser19 myosin regulatory light chain Cell signaling Cat#3671S Rat anti-αTubulin (YL1/2) Santa Cruz Biotechnology Cat#sc-53029 Rabbit anti-phosphohistone H3 Ser10 Sigma-Aldrich Cat#9701S Bacterial and Virus Strains Biological Samples Chemicals, Peptides, and Recombinant Proteins Serotonin Sigma-Aldrich Cat#H7752 CK666 Tocris Cat#3950 ZM447439 Tocris Cat#2458 Nocodazole Selleckchem Cat#S2775 Critical Commercial Assays Deposited Data Experimental Models: Cell Lines Experimental Models: Organisms/Strains Chlamys rubida San Juan Island, WA N/A Chlamys hastata San Juan Island, WA N/A Crassostrea gigas San Juan Island, WA N/A Oligonucleotides Recombinant DNA Software and Algorithms GraphPad Prism 6 Two-way ANOVA with Tukey-Kramer’s post-hoc test; GraphPad Prism v6.00 for Apple, GraphPad Software, San Diego California USA. www.graphpad.com Other Open in a separate window KEY RESOURCES TABLE Polar lobe initiation in mollusks is independent of cytokinetic signaling.

    Techniques: Virus, Recombinant, Software